Sequence ID | >WENV183613481 |
Genome ID | OODU01004917 |
Search identical group | |
Phylum/Class | [OODU] human gut metagenome; human gut |
Species | |
Start position on genome | 1567 |
End posion on genome | 1641 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
taagacaagt |
tRNA gene sequence |
GCGGAAGTAGCTCAGTGGTAGAGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAGCC |
Downstream region at tRNA end position |
taagaaattg |
Secondary structure (Cloverleaf model) | >WENV183613481 Gly GCC t TCCA taagaaattg G - C C - G G - C G - C A - T A - T G + T C G T T G C T C A G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |