Sequence ID | >WENV183615731 |
Genome ID | OOEB01114618 |
Search identical group | |
Phylum/Class | [OOEB] marine metagenome; sea ice |
Species | |
Start position on genome | 185 |
End posion on genome | 260 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ttattgtgat |
tRNA gene sequence |
GCTGGCGTAGCTCAGTTGGTAGAGCAGCTGACTTGTAATCAGCCGGTCGGGGGTTCGACT |
Downstream region at tRNA end position |
actatttaat |
Secondary structure (Cloverleaf model) | >WENV183615731 Thr TGT t TCCA actatttaat G - C C - G T - A G - C G + T C - G G - C T C T T C T C C A T G A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C T A A CGGTC G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |