| Sequence ID | >WENV183616165 |
| Genome ID | OOEC01128037 |
| Phylum/Class | [OOEC] marine metagenome; sea ice |
| Species | |
| Start position on genome | 154 |
| End posion on genome | 81 |
| Amino Acid | Glu |
| Anticodon | CTC |
| Upstream region at tRNA start position |
agttgcgaac |
| tRNA gene sequence |
GGCTCCATCGTTTAGCGGCCCAGGACGCTGCCCTCTCACGGCAGTAGCGCGGGTTCGAAT |
| Downstream region at tRNA end position |
attctcgctt |
| Secondary structure (Cloverleaf model) | >WENV183616165 Glu CTC
c ACaa attctcgctt
G - C
G + T
C - G
T - A
C - G
C - G
A - T T A
T C G C C C A
C G A C | | | | | G
G T T T G G C G G G C
G + + | | T T
C G G A C
C C A G TAGC
C - G
T - A
G - C
C - G
C - G
C C
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |