Sequence ID | >WENV183616488 |
Genome ID | OOED01045426 |
Search identical group | |
Phylum/Class | [OOED] marine metagenome; seawater |
Species | |
Start position on genome | 181 |
End posion on genome | 109 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tattgataac |
tRNA gene sequence |
GGGTAATTAACTCAGCGGTAGAGTGTCTGCCTTACAAGCAGAAGGTCACAGGTTCAAATC |
Downstream region at tRNA end position |
taactaaggg |
Secondary structure (Cloverleaf model) | >WENV183616488 Val TAC c ACac taactaaggg G - C G - C G - C T - A A - T A - T T - A T A T T G T C C A G A A | | | | | A C C T C A A C A G G C G | | | | T T G G A G T T A G AGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |