Sequence ID | >WENV183617537 |
Genome ID | OOEG01005765 |
Search identical group | |
Phylum/Class | [OOEG] marine metagenome; sea ice |
Species | |
Start position on genome | 751 |
End posion on genome | 827 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
agccataacc |
tRNA gene sequence |
GGGTCGGTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
acattcctgg |
Secondary structure (Cloverleaf model) | >WENV183617537 Ile GAT c ACCA acattcctgg G - C G - C G - C T - A C - G G - C G + T T G T C C T C C A G G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |