| Sequence ID | >WENV183620369 |
| Genome ID | OOFR01045193 |
| Phylum/Class | [OOFR] marine metagenome; seawater |
| Species | |
| Start position on genome | 156 |
| End posion on genome | 229 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ttttttgctt |
| tRNA gene sequence |
GGCGGAGTAGCTCAGGTGGTAGAGCAAGCGGCTCATAATCGCTGTGTCGCCGGTTCAAGT |
| Downstream region at tRNA end position |
gatttatggc |
| Secondary structure (Cloverleaf model) | >WENV183620369 Met CAT
t ACaa gatttatggc
G + T
G - C
C - G
G - C
G + T
A C
G - C T G
T C G G C C A
G G A A | | | | | A
T C T C G G C C G G C
G | | | | T T
G G A G C
T A A GTGTC
A - T
G - C
C - G
G - C
G + T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |