Sequence ID | >WENV183627991 |
Genome ID | OOGM01000325 |
Search identical group | |
Phylum/Class | [OOGM] marine metagenome; sea ice |
Species | |
Start position on genome | 2758 |
End posion on genome | 2845 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tataagatcT |
tRNA gene sequence |
GGGAATGTGGTGAAATTGGTAGACACGATGGACTTAAAATCCATTGCCTAGTGATAGGCG |
Downstream region at tRNA end position |
aataaaatta |
Secondary structure (Cloverleaf model) | >WENV183627991 Leu TAA T AAtc aataaaatta G - C G - C G - C A - T A - T T + G G - C T G T C T C C C A T A A G | | | | | A T A G T G G A G G G C G | | | T T G A C A C T A G G TGCCTAGTGATAGGCGT A - T T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |