Sequence ID | >WENV183648513 |
Genome ID | OQVS01018403 |
Search identical group | |
Phylum/Class | [OQVS] human gut metagenome; human gut |
Species | |
Start position on genome | 1707 |
End posion on genome | 1794 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atgtccacaa |
tRNA gene sequence |
GGAGAGATGTCCGAGTGGTTTAAGGAAGCAGTCTTGAAAACTGCCGTACGGCAACGTACC |
Downstream region at tRNA end position |
ttttttattg |
Secondary structure (Cloverleaf model) | >WENV183648513 Ser TGA a GCCA ttttttattg G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A T G A G | | | | | G G G C C T G T G G G C G | | | T T T A G G A T T A A CGTACGGCAACGTACC G - C C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |