Sequence ID | >WENV183655359 |
Genome ID | OQWD01014994 |
Search identical group | |
Phylum/Class | [OQWD] human gut metagenome; human gut |
Species | |
Start position on genome | 1259 |
End posion on genome | 1183 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tataagattt |
tRNA gene sequence |
GGGCTGATAGCTCAGTTGGTTAGAGCACACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
tgctatctca |
Secondary structure (Cloverleaf model) | >WENV183655359 Ile GAT t ACCA tgctatctca G - C G - C G - C C - G T - A G - C A - T T G T T C A C C A T G A A + | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A A AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |