Sequence ID | >WENV183662104 |
Genome ID | ORJL010165735 |
Search identical group | |
Phylum/Class | [ORJL] groundwater metagenome; groundwater |
Species | |
Start position on genome | 3210 |
End posion on genome | 3286 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ctgtaaaagt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCTTGGTAGCGTATCTGAATGGGGTTCAGAGGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
ataaaattat |
Secondary structure (Cloverleaf model) | >WENV183662104 Pro GGG t ACCA ataaaattat C - G G - C G - C G - C G - C C - G G - C T A T T C T C C A C G A A + | | | | A T C G C G G G A G G C T | | | + T T G G C G T G T A A GGGTC T - A C - G T - A G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |