Sequence ID | >WENV183672654 |
Genome ID | ORJL011195680 |
Search identical group | |
Phylum/Class | [ORJL] groundwater metagenome; groundwater |
Species | |
Start position on genome | 296 |
End posion on genome | 372 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
gacggctttc |
tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCAGAGGTTCAAA |
Downstream region at tRNA end position |
aattcgcccg |
Secondary structure (Cloverleaf model) | >WENV183672654 fMet CAT c ACCA aattcgcccg C A G - C C - G G - C G - C G - C G - C T A T T C T C C A C G A G | | | | | A C C G A G A G A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |