Sequence ID | >WENV183675404 |
Genome ID | ORJL011506627 |
Search identical group | |
Phylum/Class | [ORJL] groundwater metagenome; groundwater |
Species | |
Start position on genome | 1536 |
End posion on genome | 1463 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gaccccttgc |
tRNA gene sequence |
TGGGAGGTCGTTCAACGGTAGGACAGCAGACTCTGACTCTGCTTATCGGGGTTCGAATCC |
Downstream region at tRNA end position |
attcttcaat |
Secondary structure (Cloverleaf model) | >WENV183675404 Gln CTG c GCCA attcttcaat T - A G - C G - C G - C A - T G - C G - C T A T G T C C C A A A C | + | | | G C C T T G C G G G G C G | + | | T T G G G A C T A A TTAT G - C C - G A - T G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |