Sequence ID | >WENV183677571 |
Genome ID | ORJL011772873 |
Search identical group | |
Phylum/Class | [ORJL] groundwater metagenome; groundwater |
Species | |
Start position on genome | 1 |
End posion on genome | 77 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCCGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGCGGGTTCAAA |
Downstream region at tRNA end position |
aagatacttg |
Secondary structure (Cloverleaf model) | >WENV183677571 fMet CAT n ACCA aagatacttg C A G - C C - G G - C G - C G - C G - C T A T C G C C C A T G A G | | | | | A C C G A G G C G G G C C | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |