Sequence ID | >WENV183678434 |
Genome ID | ORJL011879037 |
Search identical group | |
Phylum/Class | [ORJL] groundwater metagenome; groundwater |
Species | |
Start position on genome | 866 |
End posion on genome | 791 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccctctttgc |
tRNA gene sequence |
GGGTCGTTAGCTCAGCTGGTAGAGCAGCGGACTTTTAATCCGTTGGTCGCAGGTTCGACT |
Downstream region at tRNA end position |
tcaattcaag |
Secondary structure (Cloverleaf model) | >WENV183678434 Lys TTT c ACCA tcaattcaag G + T G - C G - C T + G C - G G - C T - A T C T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A TGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |