| Sequence ID | >WENV183681284 |
| Genome ID | ORMF010284114 |
| Phylum/Class | [ORMF] groundwater metagenome; groundwater |
| Species | |
| Start position on genome | 316 |
| End posion on genome | 392 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
cctctggagg |
| tRNA gene sequence |
GGGCTAGTAGCTCAGCTGGTTAGAGCGCGCGCTTGATAAGCGTGAGGTCGGAGGTTCAAA |
| Downstream region at tRNA end position |
ctttcagatg |
| Secondary structure (Cloverleaf model) | >WENV183681284 Ile GAT
g ACCA ctttcagatg
G - C
G - C
G - C
C - G
T + G
A - T
G - C T A
T C C T C C A
C G A A | | | | | A
T C T C G G G A G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
G + T
C - G
G - C
C - G
T A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |