| Sequence ID | >WENV183690148 |
| Genome ID | ORMF011550226 |
| Phylum/Class | [ORMF] groundwater metagenome; groundwater |
| Species | |
| Start position on genome | 660 |
| End posion on genome | 736 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
tctttgtctg |
| tRNA gene sequence |
GCTGGCGTAGCTCAGTCCGGTAGAGCAGCTGATTTGTAATCAGCCGGTCGGGGGTTCAAA |
| Downstream region at tRNA end position |
ccggtcgaat |
| Secondary structure (Cloverleaf model) | >WENV183690148 Thr TGT
g TCCA ccggtcgaat
G - C
C - G
T - A
G - C
G - C
C - G
G - C T A
T C T C C C A
T G A A | + | | | A
C C T C G G G G G G C
C | | | | T T
G G A G C
G T A A CGGTC
G - C
C - G
T - A
G - C
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |