Sequence ID | >WENV183693754 |
Genome ID | ORMF012130807 |
Search identical group | |
Phylum/Class | [ORMF] groundwater metagenome; groundwater |
Species | |
Start position on genome | 140 |
End posion on genome | 215 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aagcccttta |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACATCACCCTTTCACGGTGAGTACGGGGGTTCGAAT |
Downstream region at tRNA end position |
attaatccaa |
Secondary structure (Cloverleaf model) | >WENV183693754 Glu TTC a GCCA attaatccaa G - C T - A C - G C - G C - G C - G A - T T A T C C C C C A A G A C | | | | | G G T C T G G G G G G C G + | | | T T C G G A C C T A A GTAC T - A C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |