Sequence ID | >WENV183697694 |
Genome ID | OUNK010021627 |
Search identical group | |
Phylum/Class | [OUNK] metagenome; soil |
Species | |
Start position on genome | 797 |
End posion on genome | 721 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttgataatgt |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGGCAGCCTCCGAAGCTGTAGGTCAGAAGTTCGAA |
Downstream region at tRNA end position |
tacttccctg |
Secondary structure (Cloverleaf model) | >WENV183697694 Arg CCG t ACCA tacttccctg G - C C - G G - C C - G C - G C - G G - C T A T T C T T C A C G A A | | | | | G T C T C G A G A A G C G | | | | T T G G A G C A T A G AGGTC G + T C - G A - T G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |