Sequence ID | >WENV183703075 |
Genome ID | PDVJ01002417 |
Search identical group | |
Phylum/Class | [PDVJ] alkali sediment metagenome; glacial lake sediment |
Species | |
Start position on genome | 5000 |
End posion on genome | 5072 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gagcacatct |
tRNA gene sequence |
GCGCCGATAGTGTAGTGGTTATCACTAGGCGTTGCCAACGCCTAAACCCGGGTTCGAGTC |
Downstream region at tRNA end position |
ttcatcatct |
Secondary structure (Cloverleaf model) | >WENV183703075 Gly GCC t ACat ttcatcatct G - C C - G G - C C - G C - G G - C A - T T G T G G C C C A T G A A | | | | | G G T G T G C C G G G C G | | | T T T T C A C T A T AAAC A - T G - C G - C C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |