Sequence ID | >WENV183703309 |
Genome ID | PDVJ01008721 |
Search identical group | |
Phylum/Class | [PDVJ] alkali sediment metagenome; glacial lake sediment |
Species | |
Start position on genome | 2326 |
End posion on genome | 2250 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
acgatttgat |
tRNA gene sequence |
GGGCTTGTAGCTCAGTTGGCTAGAGCACACGACTGATAATCGTGAGGTCGCTGGTTCGAG |
Downstream region at tRNA end position |
acctttttgg |
Secondary structure (Cloverleaf model) | >WENV183703309 Ile GAT t ACCA acctttttgg G - C G - C G - C C - G T + G T - A G - C T G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C C T A A AGGTC C - G A - T C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |