| Sequence ID | >WENV183707103 |
| Genome ID | PDWI01006697 |
| Phylum/Class | [PDWI] oral metagenome; swab sample of gingival sulcus (mouth) from 29 year old lactating female Dolphin_Z |
| Species | |
| Start position on genome | 7184 |
| End posion on genome | 7110 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
ttcgacaaga |
| tRNA gene sequence |
AGGCGCGTAGCTCAGGGGGAGAGCATTTGCTTGACGTGCAAAGGGTCGTGGGTTCAAATC |
| Downstream region at tRNA end position |
gaaatccccg |
| Secondary structure (Cloverleaf model) | >WENV183707103 Val GAC
a ACCA gaaatccccg
A - T
G - C
G - C
C - G
G - C
C - G
G - C T A
T C T C C C A
G A A | | | | A
G C T C G G T G G G C
G | | | | T T
G G A G C
G A A GGGTC
T - A
T - A
T - A
G - C
C - G
T T
T G
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |