Sequence ID | >WENV183708585 |
Genome ID | PDWI01017632 |
Search identical group | |
Phylum/Class | [PDWI] oral metagenome; swab sample of gingival sulcus (mouth) from 29 year old lactating female Dolphin_Z |
Species | |
Start position on genome | 9079 |
End posion on genome | 9004 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tacatgatgc |
tRNA gene sequence |
TGGGGCGTCGCCAAGCTGGCAAGGCAACGGGTTTTGGTCTCGTCATTCGGAGGTTCGAAT |
Downstream region at tRNA end position |
atttttgagg |
Secondary structure (Cloverleaf model) | >WENV183708585 Gln TTG c GCCA atttttgagg T - A G - C G - C G - C G - C C - G G - C T A T C T T C C A C G A C | + | | | G T A C C G G G A G G C G | | | T T G A G G C C A A CATTC A - T C - G G - C G + T G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |