Sequence ID | >WENV183708596 |
Genome ID | PDWI01017765 |
Search identical group | |
Phylum/Class | [PDWI] oral metagenome; swab sample of gingival sulcus (mouth) from 29 year old lactating female Dolphin_Z |
Species | |
Start position on genome | 547 |
End posion on genome | 621 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gggtatacac |
tRNA gene sequence |
TGGGGCGTCGCCAAGCGGTAAGGCACCGGGTTTTGATCCCGGCATTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
ccgtcaatag |
Secondary structure (Cloverleaf model) | >WENV183708596 Gln TTG c GCCA ccgtcaatag T - A G - C G - C G - C G - C C - G G - C T A T C G T C C A G A C | + | | | G C A C C G G T A G G C G | | | T T G A G G C T A A CATTC C - G C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |