Sequence ID | >WENV183708610 |
Genome ID | PDWI01017947 |
Search identical group | |
Phylum/Class | [PDWI] oral metagenome; swab sample of gingival sulcus (mouth) from 29 year old lactating female Dolphin_Z |
Species | |
Start position on genome | 96 |
End posion on genome | 11 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agtagtttgc |
tRNA gene sequence |
GGAGAGGTGACCGAGTGGCTTAAGGTGCACGCCTGGAACGCGTGTGTACGCAAGTACCGA |
Downstream region at tRNA end position |
tatattaaaa |
Secondary structure (Cloverleaf model) | >WENV183708610 Ser GGA c GCCA tatattaaaa G - C G - C A - T G - C A - T G - C G - C T A T C T C T C A T G A G | | | | | G G G C C A G A G A G C G | | | T T C A G G T T T A G TGTACGCAAGTACC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |