Sequence ID | >WENV183711218 |
Genome ID | PDWI01063519 |
Search identical group | |
Phylum/Class | [PDWI] oral metagenome; swab sample of gingival sulcus (mouth) from 29 year old lactating female Dolphin_Z |
Species | |
Start position on genome | 123 |
End posion on genome | 195 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cattgtttta |
tRNA gene sequence |
GCCGTTGTAGCTCAGTCGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGACAGTTCGATT |
Downstream region at tRNA end position |
attttataat |
Secondary structure (Cloverleaf model) | >WENV183711218 Phe GAA a Attc attttataat G - C C - G C - G G - C T - A T + G G - C T T T C T G T C A T G A A | | | | | G C C T C G G A C A G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |