Sequence ID | >WENV183716590 |
Genome ID | PDWJ01000063 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 162876 |
End posion on genome | 162951 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gggaacagat |
tRNA gene sequence |
GCCTCAATAGCTCAGCTGGTAGAGCAGGTCCTTCGTAAGGACAAGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
tttttcataa |
Secondary structure (Cloverleaf model) | >WENV183716590 Thr CGT t ACCA tttttcataa G - C C - G C - G T - A C - G A - T A - T T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A G - C T - A C - G C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |