Sequence ID | >WENV183717888 |
Genome ID | PDWJ01001877 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 2610 |
End posion on genome | 2521 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaacgcccac |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTAGGCGGGAGACCGTC |
Downstream region at tRNA end position |
gattttcttg |
Secondary structure (Cloverleaf model) | >WENV183717888 Ser GGA c GCCA gattttcttg G - C G - C A - T C - G A - T G - C G + T T A T G T C C C A T G A G | | | | | G G G C C G C A G G G C G | | | T T T A G G C C G A G TAGGCGGGAGACCGTCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |