Sequence ID | >WENV183717889 |
Genome ID | PDWJ01001878 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 45639 |
End posion on genome | 45565 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tcaccatttt |
tRNA gene sequence |
GCGGAAGTGGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
tgtggcggca |
Secondary structure (Cloverleaf model) | >WENV183717889 Gly GCC t TCCA tgtggcggca G - C C - G G - C G - C A - T A - T G - C T A T T G C C C A G A G + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |