Sequence ID | >WENV183718353 |
Genome ID | PDWJ01003523 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 9221 |
End posion on genome | 9296 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ctcaaacggc |
tRNA gene sequence |
GGGTCGTTAACTCAGCCGGTAGAGTATCTGCCTTTTAAGCAGAGAGTCGCGCGTTCGAGC |
Downstream region at tRNA end position |
atattgtctg |
Secondary structure (Cloverleaf model) | >WENV183718353 Lys TTT c ACCA atattgtctg G - C G - C G - C T - A C - G G - C T - A C G T C G C G C A C G A A | | | | | G C C T C A G C G C G C G | | | | T T G G A G T T A A GAGTC T - A C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |