Sequence ID | >WENV183718621 |
Genome ID | PDWJ01005488 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 320 |
End posion on genome | 246 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
taattgatgt |
tRNA gene sequence |
GGTCCCATCGTCTAGCGGTTAGGACGCTGGCCTCTCACGCCGGAAACCCGGGTTCGATTC |
Downstream region at tRNA end position |
attagaggat |
Secondary structure (Cloverleaf model) | >WENV183718621 Glu CTC t ACCA attagaggat G - C G + T T - A C - G C - G C - G A - T T T T G G C C C A C G A C | | | | | G G T C T G C C G G G C G + | | | T T T G G A C T A G AAAC C - G T + G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |