Sequence ID | >WENV183718851 |
Genome ID | PDWJ01007006 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 252 |
End posion on genome | 328 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttacaataat |
tRNA gene sequence |
GGCGATGTAGCTCAGATGGTTAGAGCATACGGCTCATATCCGTAGTGTCCGGGGTTCAAT |
Downstream region at tRNA end position |
ttagacattc |
Secondary structure (Cloverleaf model) | >WENV183718851 Met CAT t ACCA ttagacattc G - C G - C C - G G - C A - T T - A G - C T T T G T C C C A A G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC T - A A - T C - G G - C G - C C T T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |