Sequence ID | >WENV183719112 |
Genome ID | PDWJ01009838 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 6607 |
End posion on genome | 6683 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ctagtagtta |
tRNA gene sequence |
CGGGGTGTAGCGCAGTTTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGCGGGTTCAAA |
Downstream region at tRNA end position |
ttttttttta |
Secondary structure (Cloverleaf model) | >WENV183719112 Pro TGG a ACCA ttttttttta C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A T G A A | | + | | A T C G C G G C G G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |