Sequence ID | >WENV183720415 |
Genome ID | PDWJ01033784 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 729 |
End posion on genome | 805 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aacaaatcaa |
tRNA gene sequence |
CGGGGCGTAGCGCAGTCTGGTAGCGCACTTGTCTGGGGGACAAGTGGTCGCAAGTTCAAA |
Downstream region at tRNA end position |
ttaaaaataa |
Secondary structure (Cloverleaf model) | >WENV183720415 Pro GGG a ACCA ttaaaaataa C - G G - C G - C G - C G + T C - G G - C T A T C G T T C A T G A A | | | | | A C C G C G G C A A G C T | | | | T T G G C G C G T A A TGGTC C - G T - A T - A G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |