Sequence ID | >WENV183720681 |
Genome ID | PDWJ01041418 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 1 |
End posion on genome | 74 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCGCCCGTAGCTCAACGGATAGAGCATCTGACTACGGATCAGAAGGTTAGGGGTTCGAAT |
Downstream region at tRNA end position |
cacgaattcc |
Secondary structure (Cloverleaf model) | >WENV183720681 Arg ACG n GCag cacgaattcc G - C C - G G - C C - G C - G C - G G - C T A T T T C C C A C A A A | + | | | G G C T C G A G G G G C G | | | | T T A G A G C T A A AGGTT T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |