Sequence ID | >WENV183720722 |
Genome ID | PDWJ01042923 |
Search identical group | |
Phylum/Class | [PDWJ] oral metagenome; swab sample of gingival sulcus (mouth) from 5 year old male Dolphin_J |
Species | |
Start position on genome | 635 |
End posion on genome | 549 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cttctgcgtt |
tRNA gene sequence |
GCCGAAGTGGCGGAATTGGTAGACGCGCTAGGTTCAGGGTCTAGTGGGGGTTCCCCCGTG |
Downstream region at tRNA end position |
tttttataaa |
Secondary structure (Cloverleaf model) | >WENV183720722 Leu CAG t ACCA tttttataaa G - C C - G C - G G - C A - T A - T G - C T G T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G G TGGGGGTTCCCCCGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |