Sequence ID | >ENV08000898 |
Genome ID | ABML01066553 |
Phylum/Class | Marine metagenome ; viral fraction from water below the boundary layer (eg, crevices and benthic surfaces) of Palmyra (Northern Line Islands) |
Species | |
Start position on genome | 1 |
End posion on genome | 94 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
TGGGAGGTGGCGGAATTGGCAGACGCGCCATCCTGTTTCGATTGTGGTGATAACGTGAAA |
Downstream region at tRNA end position |
taccccttag |
Secondary structure (Cloverleaf model) | >ENV08000898 Asn GTT n Gtat taccccttag T - A G - C G - C G + T A - T G - C G - C T A T C A T C C A T A A G | | | | | G T G G C G G T A G G C G | | | T T G A C G C C A G G TGGTGATAACGTGAAAACGCACTTT C - G C T A - T T - A C - G C C T T G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |