| Sequence ID | >ENV08000922 |
| Genome ID | ABML01176317 |
| Phylum/Class | Marine metagenome ; viral fraction from water below the boundary layer (eg, crevices and benthic surfaces) of Palmyra (Northern Line Islands) |
| Species | |
|
Start position on genome
|
100
|
|
End posion on genome
|
23
|
|
Amino Acid
|
Asn
|
|
Anticodon
|
GTT
|
|
Upstream region at tRNA start position
|
nnnnntttat
|
|
tRNA gene sequence
|
TGCCCCTTAGCTCTAGTTGGTTAGAGCAGCTGACTGTTAATCAGCGGGTCCGCGGTTCGA GTCCGCGAGGGGCAGCCA
|
|
Downstream region at tRNA end position
|
tcttaatata
|
| Secondary structure (Cloverleaf model) | >ENV08000922 Asn GTT
t GCCA tcttaatata
T - A
G - C
C - G
C - G
C - G
C - G
T - A T G
T G C G C C A
T G A T A | | | | | G
T C T C G C G C G G C
G | | | | T T
G G A G C
T T A A GGGTC
G - C
C - G
T - A
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |