Sequence ID | >WENV183723923 |
Genome ID | PEHZ01005381 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 37 |
End posion on genome | 119 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acgccagcac |
tRNA gene sequence |
GGCAGGTTGCCCGAGTGGCCAAAGGGAGCGGTCTGTAAAACCGTCGGTTTCGCCTACGTT |
Downstream region at tRNA end position |
aaccccccgg |
Secondary structure (Cloverleaf model) | >WENV183723923 Tyr GTA c ACgc aaccccccgg G - C G - C C - G A - T G - C G - C T - A T A T C A A C C A T G A G | | | | | G G G C C C G T T G G C G | | | T T C A G G G C A A A CGGTTTCGCCTAC G + T C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |