Sequence ID | >WENV183723937 |
Genome ID | PEHZ01009044 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 48 |
End posion on genome | 138 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cacggcactt |
tRNA gene sequence |
GGAGGTGTCGCCTAGTCAGGTCTATGGCGCCCGCCTGCTAAGCGGGTTTGGGAGGTAATC |
Downstream region at tRNA end position |
atgcccggtg |
Secondary structure (Cloverleaf model) | >WENV183723937 Ser GCT t GCgg atgcccggtg G - C G - C A - T G - C G - C T - A G - C T A T C G C C C A C T G A C | | | | | A A T C C G G C G G G C G | | | T T G T G G C T C T A G TTTGGGAGGTAATCCCATC C - G C - G C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |