Sequence ID | >WENV183724037 |
Genome ID | PEHZ01018970 |
Phylum/Class | [PEHZ] insect metagenome; viral sequences isolated from a pool of bees; samples treated with nuclease to minimize the |
Species | |
Start position on genome | 858 |
End posion on genome | 945 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ccttatttac |
tRNA gene sequence |
GGTGACGTGTCTGAGCGGCCGAAAGTGCCCGCCTCGAAAGCGGGTGTAGCGAGAGCTACC |
Downstream region at tRNA end position |
gctgggtccc |
Secondary structure (Cloverleaf model) | >WENV183724037 Ser CGA c GCCA gctgggtccc G - C G - C T - A G - C A - T C - G G - C T A T C T C C C A C G A G | | | | | A G G T C T G A G G G C G | | T T C A A G T C G A G TGTAGCGAGAGCTACC C - G C - G C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |