Sequence ID | >WENV183726020 |
Genome ID | PJQF01060749 |
Search identical group | |
Phylum/Class | [PJQF] biofilm metagenome; biomolecule (vanillin) treated reverse osmosis membrane biofilm |
Species | |
Start position on genome | 396 |
End posion on genome | 322 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gtcggtcgcc |
tRNA gene sequence |
GGGCGGTTAGCTCAGTGGCAGAGCGCCTCGTTTACACCGAGGATGTCGGGAGTTCGACCC |
Downstream region at tRNA end position |
tttttccggc |
Secondary structure (Cloverleaf model) | >WENV183726020 Val TAC c ACCA tttttccggc G - C G - C G - C C - G G - C G - C T - A C C T C T C T C A G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C C A G ATGTC C - G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |