Sequence ID | >WENV183726985 |
Genome ID | PJTO01001273 |
Search identical group | |
Phylum/Class | [PJTO] soil metagenome; Soil (3) enriched on wood chips: beechwood xylan treatment |
Species | |
Start position on genome | 3401 |
End posion on genome | 3490 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tgcgcgacgc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTAGACGGGGAACCGTC |
Downstream region at tRNA end position |
gaattcctag |
Secondary structure (Cloverleaf model) | >WENV183726985 Ser GGA c GCCA gaattcctag G - C G - C A - T G - C A - T G - C G + T T A T T T C C C A T G A G | | | | | G G G C C G A A G G G C G | | | T T T A G G C C G A G TAGACGGGGAACCGTCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |