| Sequence ID | >WENV183729357 |
| Genome ID | PJTQ01026786 |
| Phylum/Class | [PJTQ] soil metagenome; Soil (3) enriched on wood chips |
| Species | |
| Start position on genome | 331 |
| End posion on genome | 255 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ccaatggcct |
| tRNA gene sequence |
GGTGATGTAGCTCAGCTGGTTAGAGCACAGGATTCATAATCCTGGGGTCGAGGGTTCAAG |
| Downstream region at tRNA end position |
atacttttct |
| Secondary structure (Cloverleaf model) | >WENV183729357 Met CAT
t ACCA atacttttct
G - C
G - C
T - A
G - C
A - T
T - A
G - C T G
T C C C C C A
C G A A | | | | A
T C T C G G A G G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
A - T
G - C
G - C
A - T
T A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |