Sequence ID | >WENV183729407 |
Genome ID | PJTQ01035598 |
Search identical group | |
Phylum/Class | [PJTQ] soil metagenome; Soil (3) enriched on wood chips |
Species | |
Start position on genome | 479 |
End posion on genome | 552 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttcactccat |
tRNA gene sequence |
AGGGTAGTGGCGCAATTGGTAGCGCAGCGGTCTCCAAAACCGCAGGTTGCAGGTTCGAGT |
Downstream region at tRNA end position |
aagctgcccc |
Secondary structure (Cloverleaf model) | >WENV183729407 Trp CCA t GCgc aagctgcccc A - T G - C G - C G - C T + G A - T G - C T G T T G T C C A T A A G + | | | | G T C G C G G C A G G C G | | | | T T G G C G C T A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |