Sequence ID | >WENV183730931 |
Genome ID | PJTS01002194 |
Search identical group | |
Phylum/Class | [PJTS] soil metagenome; Soil (2) enriched on wood chips: alkali lignin treatment |
Species | |
Start position on genome | 4594 |
End posion on genome | 4521 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaattacat |
tRNA gene sequence |
TGCGGGATGGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCATCAGTTCGAGT |
Downstream region at tRNA end position |
aagaagccct |
Secondary structure (Cloverleaf model) | >WENV183730931 fMet CAT t ACgg aagaagccct T T G - C C - G G - C G - C G - C A - T T G T T G G T C A T G A G | + | | | G T C G A G A T C A G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |