Sequence ID | >WENV183732522 |
Genome ID | PJTX01001453 |
Search identical group | |
Phylum/Class | [PJTX] soil metagenome; Soil enriched (2) on filter paper: beechwood xylan treatment |
Species | |
Start position on genome | 691 |
End posion on genome | 616 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aaccgccctc |
tRNA gene sequence |
GGGTGCATAGCTCAGATGGTAGAGCAGCTGACTCTTAATCAGCGGGTCCAAGGTTCGAGC |
Downstream region at tRNA end position |
aagttttcaa |
Secondary structure (Cloverleaf model) | >WENV183732522 Lys CTT c ACCA aagttttcaa G - C G - C G - C T - A G - C C - G A - T C G T G T T C C A A G A A | | | | | G T C T C G C A A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |