Sequence ID | >WENV183734630 |
Genome ID | PJTZ01027038 |
Search identical group | |
Phylum/Class | [PJTZ] soil metagenome; Soil enriched (2) on filter paper |
Species | |
Start position on genome | 445 |
End posion on genome | 522 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ttacgacgcT |
tRNA gene sequence |
GGTCCTATAGCTCAGTCGGTTAGAGCATCTGACTCATAATCAGAGGGTCCTTGGTTCGAG |
Downstream region at tRNA end position |
tannnnnnnn |
Secondary structure (Cloverleaf model) | >WENV183734630 Ile2 CAT T ACCC tannnnnnnn G - C G - C T - A C - G C - G T + G A - T C G T G A G C C A T G A A | | + | | G C C T C G C T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |