Sequence ID | >WENV183738133 |
Genome ID | PJUD01088720 |
Search identical group | |
Phylum/Class | [PJUD] feces metagenome; Chicken feces (3) enriched on wood chips: beechwood xylan treatment |
Species | |
Start position on genome | 145 |
End posion on genome | 71 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tacgactcta |
tRNA gene sequence |
GGGTGCGTAGCTCAGCTGGATAGACCATCTGCCTTCTAAGCAGACGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
aactcacaat |
Secondary structure (Cloverleaf model) | >WENV183738133 Arg TCT a ACag aactcacaat G - C G + T G - C T + G G - C C - G G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | T T G G A C C A T A A CGGTC T - A C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |