Sequence ID | >WENV183739645 |
Genome ID | PJUE01047658 |
Search identical group | |
Phylum/Class | [PJUE] feces metagenome; Chicken feces (3) enriched on wood chips: alkali lignin treatment |
Species | |
Start position on genome | 167 |
End posion on genome | 91 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ccacgccgaa |
tRNA gene sequence |
CTGCCCTTAGCTCAACTGGATAGAGCAATGGCCTTCTAAGCCATAGGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
tatcactggc |
Secondary structure (Cloverleaf model) | >WENV183739645 Arg TCT a GCCA tatcactggc C - G T - A G - C C - G C - G C - G T - A T G T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A AGGTC A - T T - A G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |