| Sequence ID | >WENV183745570 |
| Genome ID | POVV01000096 |
| Phylum/Class | [POVV] bioreactor metagenome; anaerobic chemostat enrichment culture, galacturonate as sole carbon source, pH 8; inoculated with |
| Species | |
|
Start position on genome
|
69870
|
|
End posion on genome
|
69942
|
|
Amino Acid
|
Trp
|
|
Anticodon
|
CCA
|
|
Upstream region at tRNA start position
|
cacactttgT
|
|
tRNA gene sequence
|
AGGGGATTGGTCAAATGGTATGATAGGGGTCTCCAAAACCTTTGGTGGGAGTTCGATTCT CTCATCCCCTGTtt
|
|
Downstream region at tRNA end position
|
tatatttaaa
|
| Secondary structure (Cloverleaf model) | >WENV183745570 Trp CCA
T GTtt tatatttaaa
A - T
G - C
G - C
G - C
G - C
A - T
T - A T T
T C T C T C A
A A G | + | | | G
T A C T G G G G A G C
G | | | + T T
G T G A T
T A A TGGT
G + T
G + T
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |